View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1975_high_20 (Length: 218)
Name: NF1975_high_20
Description: NF1975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1975_high_20 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 26828638 - 26828855
Alignment:
| Q |
1 |
acaatgacaagtgatggatgaggaatctgcaataaccatatactcatcctcggagaagattgtgacacaatgaaatgtttcttatttttccaatagaaca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
26828638 |
acaatgacaagtgatggatgaggaatctgcaataaccatatactcatcctcggagaagattgtgacacaatgaaatgtttcttatttttccaatagacca |
26828737 |
T |
|
| Q |
101 |
ataaagaaccaaataaaatacaaaatgtaactgaaaactgtcaaactattccagagcacgcgaggcacttgctgcaggggtggaaaaccgcaaacagcag |
200 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26828738 |
ataaagaatcaaagaaaatacaaaatgtaactgaaaactgtcaaactattccagagcacgcgaggcacttgctgcaggggtggaaaaccgcaaacagcag |
26828837 |
T |
|
| Q |
201 |
taaacagttgagtgtggc |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
26828838 |
taaacagttgagtgtggc |
26828855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University