View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1975_high_22 (Length: 207)
Name: NF1975_high_22
Description: NF1975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1975_high_22 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 161; Significance: 5e-86; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 19 - 199
Target Start/End: Original strand, 42213731 - 42213911
Alignment:
| Q |
19 |
ctgacggcttagggtctccccacagtacttgttcatccacctattacgacgctttctctgagatttcagattttgacggaacaagttactggcactcttt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
42213731 |
ctgacggcttagggtctccccacagtacttgttcatccacctattacgacgctttctctgagatttcagattttgacggaacaagttacgggcactcttt |
42213830 |
T |
|
| Q |
119 |
gctaaatcttgacgaggaagacaatggatggctctcagattcaatgacatctgagaacccttcaactcccctatgctactc |
199 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||| ||||||| |
|
|
| T |
42213831 |
gctaagtcttgacgaggaagacaatggatggctctcagattcaatgatatctgagaacccttcaactcctctaagctactc |
42213911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 19 - 197
Target Start/End: Original strand, 42206898 - 42207079
Alignment:
| Q |
19 |
ctgacggcttagggtctccccacagtacttgttcatccacctattacgacgctttctctgagatttcagattttgacggaacaagttactggcactcttt |
118 |
Q |
| |
|
|||| |||| |||||||||||| ||||||||||||||||||||||| |||| |||||| ||||||||||||||||| |||| |||||| |||||||||| |
|
|
| T |
42206898 |
ctgagggctcagggtctccccatagtacttgttcatccacctattatgacgttttctccgagatttcagattttgatagaactagttaccggcactcttt |
42206997 |
T |
|
| Q |
119 |
gctaaatcttgacgaggaagacaatggatggctct---cagattcaatgacatctgagaacccttcaactcccctatgctac |
197 |
Q |
| |
|
||||| |||||| |||||||||| || ||| ||| |||||||||||||| ||||||| ||||||||||| ||| ||||| |
|
|
| T |
42206998 |
gctaagtcttgaagaggaagacattgattgggtctcagcagattcaatgacacctgagaatccttcaactcctctaagctac |
42207079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 100 - 181
Target Start/End: Original strand, 42214214 - 42214295
Alignment:
| Q |
100 |
caagttactggcactctttgctaaatcttgacgaggaagacaatggatggctctcagattcaatgacatctgagaacccttc |
181 |
Q |
| |
|
||||||||| ||| ||||| |||| |||||| ||||||||| || |||||||||||||||||||| |||||| ||||||| |
|
|
| T |
42214214 |
caagttactcgcattctttactaagtcttgaagaggaagactctgcatggctctcagattcaatgatctctgaggacccttc |
42214295 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 100 - 181
Target Start/End: Original strand, 42214013 - 42214094
Alignment:
| Q |
100 |
caagttactggcactctttgctaaatcttgacgaggaagacaatggatggctctcagattcaatgacatctgagaacccttc |
181 |
Q |
| |
|
||||||||| ||| ||||| |||| |||||| ||||||||| || |||||| |||||||||||| ||||||||| ||||| |
|
|
| T |
42214013 |
caagttactcgcattctttactaagtcttgaagaggaagactctgaatggctttcagattcaatggtatctgagaatccttc |
42214094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University