View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1975_high_6 (Length: 389)
Name: NF1975_high_6
Description: NF1975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1975_high_6 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
| [»] scaffold0025 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 155; Significance: 3e-82; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 183 - 389
Target Start/End: Complemental strand, 46590092 - 46589887
Alignment:
| Q |
183 |
gtgtaatttgcaacagtctccttcaagctgagattggatttctccgaaatcacagttaacgtggcaaatttatcatttgctcttttaactacaaccttca |
282 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| ||||| |||||||||||| || |||||||||||||| |||||||||||||||||||| | |
|
|
| T |
46590092 |
gtgtaatttgcaacagtctcctacaagctgagattggattcctccggaatcacagttaaagttgcaaatttatcattcgctcttttaactacaaccttga |
46589993 |
T |
 |
| Q |
283 |
tgggcacccccaactttgtcaaccatcatttcaatcagctgcaacaattttatatctatgtgataatatataaataattaaacacatcaatcataatgaa |
382 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||||||| ||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
46589992 |
tgggcacccc-aactttgtccaccatcatttcaatcacctgcaacaattttatatctatgtgagaatatataaataatcaaacacatcaatcataatgaa |
46589894 |
T |
 |
| Q |
383 |
gaataat |
389 |
Q |
| |
|
||||||| |
|
|
| T |
46589893 |
gaataat |
46589887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0025 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0025
Description:
Target: scaffold0025; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 106 - 152
Target Start/End: Complemental strand, 49711 - 49665
Alignment:
| Q |
106 |
ttgtaggggtagaggtataattgttggggtaagggataaaatgttct |
152 |
Q |
| |
|
|||||||||||| |||||||||||||||||| ||| || |||||||| |
|
|
| T |
49711 |
ttgtaggggtaggggtataattgttggggtatggggtataatgttct |
49665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 106 - 150
Target Start/End: Original strand, 17972716 - 17972760
Alignment:
| Q |
106 |
ttgtaggggtagaggtataattgttggggtaagggataaaatgtt |
150 |
Q |
| |
|
|||||||||||||| |||||||||||||||| ||| || |||||| |
|
|
| T |
17972716 |
ttgtaggggtagagatataattgttggggtatggggtataatgtt |
17972760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University