View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1975_low_16 (Length: 294)
Name: NF1975_low_16
Description: NF1975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1975_low_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 240; Significance: 1e-133; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 284
Target Start/End: Original strand, 6400608 - 6400885
Alignment:
| Q |
1 |
acttaataaaccaatggtaaaaaagttgatgcacaaaatcacacgggaagatattcttgtaaaagagtgatatattggccaacatagcccactaatgaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6400608 |
acttaataaaccaatggtaaaaaagttgatgcacaaaatcacacgggaagatattcttgtaaaagagtgatatattggccaacatagcccactaatgaat |
6400707 |
T |
|
| Q |
101 |
aatgattgacatttgggaccaaaattggggactaatattactttcaattgccgtcaaggagaggtgatgctagatgctcttcttaaccctannnnnnnnn |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6400708 |
aatgattgacatttgggaccaaaattggggactaatattactttcaattgccgtcaaggagaggtgatgctagatgctcttcttaacccta------ata |
6400801 |
T |
|
| Q |
201 |
nnnnaccttgtgaatgattttcaaagccagctagttattgcatttcccagtcatttcatgcatgtgaatcgtttttgttgttgt |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6400802 |
tataaccttgtgaatgattttcaaagccagctagttattgcatttcccagtcatttcatgcatgtgaatcgtttttgttgttgt |
6400885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 243 - 284
Target Start/End: Complemental strand, 11704524 - 11704483
Alignment:
| Q |
243 |
tttcccagtcatttcatgcatgtgaatcgtttttgttgttgt |
284 |
Q |
| |
|
|||||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
11704524 |
tttccctgtcatttcatgcatgtgaatcatttttgttgttgt |
11704483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University