View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1975_low_19 (Length: 268)
Name: NF1975_low_19
Description: NF1975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1975_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 8 - 254
Target Start/End: Original strand, 32275760 - 32276006
Alignment:
| Q |
8 |
aaattatacttggttgagttcaaagtcataaacaaattaagtaacttagttctaccccatatgatagtttgttgcacccactagttaatcaagttcataa |
107 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32275760 |
aaattatatttggttgagttcaaagtcataaacaaattaagtaacttagttctaccccatatgatagtttgttgcacccactagttaatcaagttcataa |
32275859 |
T |
|
| Q |
108 |
atgcttgcttcataagtcttcatttaggggttgaattttgaaaagcataactatatattttcagactttgtttaccaatcaagatggnnnnnnnaatatt |
207 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32275860 |
atgcttgcttcataagtcttcatttagaggttgaattttgaaaagcataactatatattttcagactttgtttaccaatcaagatggtttttttaatatt |
32275959 |
T |
|
| Q |
208 |
taggtcaaattctttttaactcagaattattggtcacgtgacatatt |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32275960 |
taggtcaaattctttttaactcagaattattggtcacgtgacatatt |
32276006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University