View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1975_low_23 (Length: 229)
Name: NF1975_low_23
Description: NF1975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1975_low_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 24763202 - 24763423
Alignment:
| Q |
1 |
tatggtgatgggatgctttatatttataggtgaacgtttttctttattttctcaacagtcatcccgcaacgcgaggttgtcatggtgtggcgcgcgttgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
24763202 |
tatggtgatgggatgctttatatttataggtgagcgtttttctttattttctcaacagtcatcccgcaacgcgaggttgtcatggtgtggcgcacgttgt |
24763301 |
T |
|
| Q |
101 |
gatgagacggtacacaactcaattcctttctaatttcacaacgtgtaggtcatagtgggcatcgtgagtttggccgtggttggacatgcacatttcttca |
200 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
24763302 |
gatgagacggtacacaactcaattcc-ttctaatttcacaacgtgtaggtcatagtgggcatcatgagtttggccgtggttggacatgcacatttcttca |
24763400 |
T |
|
| Q |
201 |
cttcttgctccgtttcatctcac |
223 |
Q |
| |
|
|||||||||||||||| |||||| |
|
|
| T |
24763401 |
cttcttgctccgtttcttctcac |
24763423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University