View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19760_low_2 (Length: 426)
Name: NF19760_low_2
Description: NF19760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19760_low_2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 100; Significance: 3e-49; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 13 - 153
Target Start/End: Complemental strand, 14354754 - 14354618
Alignment:
| Q |
13 |
aatatttcgctacatatagcattgttgatacatacattatttagtagttatggaatgttttgattaatgcataaccgcaacctataacacgacattcgta |
112 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
14354754 |
aatattttgctacatatagcattgttgatacat----tatttagtagttatggaatgttttgattaatgcataaccgtaatctataacacgacattcgta |
14354659 |
T |
|
| Q |
113 |
acagtcaaaatcgtaaaatcatacatatatgtgacaacgat |
153 |
Q |
| |
|
|||||||||||||| ||||| |||||||||| ||||||||| |
|
|
| T |
14354658 |
acagtcaaaatcgtgaaatcctacatatatgcgacaacgat |
14354618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 285 - 384
Target Start/End: Complemental strand, 14354619 - 14354520
Alignment:
| Q |
285 |
attattatatataacaaatacatataacaaatggccaacacaacacaatgtctttattgatcagaannnnnnnngttgacaatcttctgaagagaattat |
384 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
14354619 |
attattatatataacaaatacatataacaaatggccaacacaacacaatgtctttattgatcagaattttttttgttgacaatcttctgaagagaattat |
14354520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University