View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19762_low_22 (Length: 338)
Name: NF19762_low_22
Description: NF19762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19762_low_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 3e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 19 - 188
Target Start/End: Complemental strand, 32800144 - 32799976
Alignment:
| Q |
19 |
ccgtcaaaacaagaatctgaactatagtattagtgtaccttgtaccgatctgtatccatttttaagtggttgatacaacaaatgtgcaggccatgaataa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32800144 |
ccgtcaaaacaagaatctgaactatagtattagtgtaccttgtactgatctgtatccatttttaagtggttgatacaacaaatgtgcaggccatgaataa |
32800045 |
T |
 |
| Q |
119 |
atagcgtaacttatgtgtcttttgatgaaaatagtagaagtctttggctaaaaagtaaacctttgaagta |
188 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
32800044 |
atagcgtaacatatttgtcttttgatgaaaatagtagaagtc-ttggctaaaaagtaaacctttgaagta |
32799976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University