View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19762_low_43 (Length: 234)
Name: NF19762_low_43
Description: NF19762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19762_low_43 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 3682590 - 3682800
Alignment:
| Q |
1 |
ctcattgttttctttaaggtttaatctttttagagctttgcttgtcataaattaaagagtgttttatctttgttgaaaagtttacttttaatgtgagtgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
3682590 |
ctcattgttttctttaaggtttaatctttttagagctttgcttgtcataaattaaagagtgttttatctttgttgaaaagtatactttttatgtgagtgt |
3682689 |
T |
 |
| Q |
101 |
ggagcttaaattgatgttttgtcgttgggttttctaaacgcatgtgtagtatttggttgttaattataatcttttgcactggatttggtctattttctct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3682690 |
ggagcttaaattgatgttttgtcgttgggttttctaaacgcatgtgtagtatttggttgttaattataatcttttgcactggatttggtctattttctct |
3682789 |
T |
 |
| Q |
201 |
tttgtcttaca |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
3682790 |
tttgtcttaca |
3682800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University