View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19763_low_16 (Length: 254)
Name: NF19763_low_16
Description: NF19763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19763_low_16 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 17 - 254
Target Start/End: Original strand, 7723635 - 7723877
Alignment:
| Q |
17 |
atatataactttatttcaatcttttgatagtttcaatttgaatgggaattacagtcactatgcaatgcatgtgggatcagattcaagaaggaagagagaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7723635 |
atatataactttatttcaatcttttgatagtttcaatttgaatgg-aattacagtcattatgcaatgcatgtgggatcagattcaagaaggaagagagaa |
7723733 |
T |
|
| Q |
117 |
gagcaacttctgccgccggcacagcgacagcgccatctattggcgtaatggagtcagcttcgatgtataaccaccaccatc------acaacaacaacaa |
210 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
7723734 |
gagcaacttctgccgctggcacagcgacagcgccatctattggcgtaatggagtcagcttcgatgtataaccaccaccaccatcacaacaacaacaacaa |
7723833 |
T |
|
| Q |
211 |
ctcatggtacgtacaaccacagaaccagaagatgcagtgtttct |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7723834 |
ctcatggtacgtacaaccacagaaccagaagatgcagtgtttct |
7723877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 54 - 120
Target Start/End: Complemental strand, 32956086 - 32956020
Alignment:
| Q |
54 |
ttgaatgggaattacagtcactatgcaatgcatgtgggatcagattcaagaaggaagagagaagagc |
120 |
Q |
| |
|
|||||| | |||| ||||||||||||||||| |||||||| |||| ||||||||||||||||||||| |
|
|
| T |
32956086 |
ttgaattgaaattgcagtcactatgcaatgcttgtgggattagatacaagaaggaagagagaagagc |
32956020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University