View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19763_low_19 (Length: 225)
Name: NF19763_low_19
Description: NF19763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19763_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 59 - 209
Target Start/End: Original strand, 43456582 - 43456732
Alignment:
| Q |
59 |
catgttactactgcttccagaagaagtagtaaaagtagtagttgttgcagtagaagaagtgatagtactattagtaccatagctgccactggaggccgct |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43456582 |
catgttactactgcttccagaagaagtagtaaaagtagtagttgttgcagtagaagaagtgatagtactattagtaccgtagctgccactggaggccgct |
43456681 |
T |
 |
| Q |
159 |
tgggaataagatatccctgcaggtgtaacttgatttgatacagacatatat |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43456682 |
tgggaataagatatccctgcaggtgtaacttgatttgatacagacatatat |
43456732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University