View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19764_low_18 (Length: 307)
Name: NF19764_low_18
Description: NF19764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19764_low_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 14 - 291
Target Start/End: Complemental strand, 13303633 - 13303356
Alignment:
| Q |
14 |
agagacaatatgtccaaactttatgactagttgcacattgtataggtattttaataatgtcgccaaatcgagtatttttgaatgattctatgtttagagg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13303633 |
agagacaatatgtccaaactttatgactagttgcacattgtataggtattttaataatgtcgccaaatcgagtatttttgaatgattctatgtttagagg |
13303534 |
T |
|
| Q |
114 |
gacatttatatttctaagtatagtagcgcgtggggatgtccctctcctgcgactcaaccctttacgggtaccgcaaataatgtatattttgttcaacatt |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
13303533 |
gacatttatatttctaagtatagtagcgcgtggggatgtccctctcctgcgactcaaccctttacgggtaccgcaaataatgtatattttgctcaacatt |
13303434 |
T |
|
| Q |
214 |
ggtcttagctcgacaaagcgtgcaaaagcttccctttatgttagggtttagggttattgacaaaattgaaagtttgtt |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
13303433 |
ggtcttagctcgacaaagcgtgcaaaagcttccctttatgttagggtttagggttattgacaaaattgaaaatttgtt |
13303356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University