View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19764_low_20 (Length: 276)
Name: NF19764_low_20
Description: NF19764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19764_low_20 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 14 - 265
Target Start/End: Original strand, 19150980 - 19151231
Alignment:
| Q |
14 |
gttattagtatccttagctatctgccatcacttgcagctacctatgactatgtcnnnnnnnnnnnnnnnnnnnncagttcaattatcataacagaaaaat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
19150980 |
gttattagtatccttagctatctgccatcacttgcagctacctatgactatgtctaaataaaaaataaaatacacagttcaattatgataacagaaaaat |
19151079 |
T |
|
| Q |
114 |
tacttctctttatttaacttagattgctcaagcagtttcttcaccaggggagtctctttaaatcttgcatcattttcagcatatttcttctggttttctt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19151080 |
tacttctctttatttaacttagattgctcaagcagtttcttcaccaggggagtctctttaaatcttgcatcattttcagcatatttcttctggttttctt |
19151179 |
T |
|
| Q |
214 |
ctgtaaaataacaatcataaaacaatgatgaaacaatatatgttagtttcat |
265 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19151180 |
ctgtaaaataataatcataaaacaatgatgaaacaatatatgttagtttcat |
19151231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University