View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19765_high_4 (Length: 270)
Name: NF19765_high_4
Description: NF19765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19765_high_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 1 - 265
Target Start/End: Original strand, 11297734 - 11297998
Alignment:
| Q |
1 |
ccatcataaccacaatcatgatcccaaccattcgcatccaacaccggcctcgtaagaaactgtgaagttgattctaagaaacgatatctaaagaccgggt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
11297734 |
ccatcataaccacaatcatgatcccaaccattcgcatccaacaccggcctcgtaagaaactgtgaagttgattctaagaaatgatatctaaagaccgggt |
11297833 |
T |
 |
| Q |
101 |
tgtcaccatcaaaggatagcggcatgatcatatcatgcaatggagtcggcactgcatctggactttccatattctgagcaccttcttctgggtagccata |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
11297834 |
tgtcaccatcaaaggatagcggcatgatcatatcatgcaatggagtcggcactgcatttggactttccatattctgagcaccttcttctgtgtagccata |
11297933 |
T |
 |
| Q |
201 |
ttctgatttacctttattcttctttatctccctcatccttctcaattcctctttcctttgcttct |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
11297934 |
ttctgatttacctttattcttctttatctccctcatccttctcaattcctctttccattgcttct |
11297998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University