View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19765_low_7 (Length: 250)
Name: NF19765_low_7
Description: NF19765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19765_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 13 - 123
Target Start/End: Original strand, 10584366 - 10584476
Alignment:
| Q |
13 |
aatatcaataatctaaacgggaactatattacaaactcatgagtcattgttttgttcaatttgttgtatataaatgataattgatgatatagtgtcaact |
112 |
Q |
| |
|
||||| |||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
10584366 |
aatattaataatctaagcggcaactatattacaaactcatgagtcattgttttgttcaatttgttgtatataaatgataattgatgatatagtctcaact |
10584465 |
T |
 |
| Q |
113 |
ccatttgctac |
123 |
Q |
| |
|
||||||||||| |
|
|
| T |
10584466 |
ccatttgctac |
10584476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 188 - 250
Target Start/End: Original strand, 10584544 - 10584606
Alignment:
| Q |
188 |
gtgtatgtttcttatcatagtgattcatcgtaatttcagcaaatttactatgatattataaca |
250 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
10584544 |
gtgtatgtttcttatcatagtgattcatgataatttcagcaaatttactatgatattataaca |
10584606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University