View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19766_high_14 (Length: 243)
Name: NF19766_high_14
Description: NF19766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19766_high_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 20 - 137
Target Start/End: Original strand, 13193932 - 13194049
Alignment:
| Q |
20 |
ttgaacttgttcccaaattacaacaaacacaactcaaaccaaataggtccagttatgacaaagacaatctcctccgttgaaacaaccgcattaccaaacc |
119 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |||| |||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
13193932 |
ttgaacttgtttccaaattacaacaaacacaacccaaatcaaataggcccagttatgacaaagacaatctcctctgttgaaacaaccgcattaccaaacc |
13194031 |
T |
 |
| Q |
120 |
atttgaacatgtctaccc |
137 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
13194032 |
atttgaacatgtctaccc |
13194049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University