View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19766_high_2 (Length: 411)
Name: NF19766_high_2
Description: NF19766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19766_high_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 19 - 399
Target Start/End: Complemental strand, 48579489 - 48579119
Alignment:
| Q |
19 |
atagtcccgtgatcttactatgcaatcttaattggacagcttcaatttcaactttgcgaaatttgtgccaagtttacaggtacaccgctgaaaaaaggct |
118 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48579489 |
atagtcacgtgatcttactatgcaatcttaattggacagcttcaat--------------atttgtgccaagtttacaggtacaccgctgaaaaaaggct |
48579404 |
T |
 |
| Q |
119 |
gcacctcaaatcacaccatcctatctcgatttaatggtcaccacgccgatgatggcatggatttgtga--------ccacgtcaaattgaaaaatgcctt |
210 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
48579403 |
gcacctcaaatcacactatcctatctcgatttaatggtcaccactgcgatgatggcatggatttgtgaatttgtaaccacgtcaaattgaaaaatgcctt |
48579304 |
T |
 |
| Q |
211 |
tttatcaccgggggcgtagcgtagccaggaggggtgtaaaccataatgataaatttttaatacattgttttagggtatattaaaccaaggcataaggagt |
310 |
Q |
| |
|
|| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
48579303 |
tt-atcaccgggggcgtagcgtagccagg---ggtgtaaaccataatgataaatttttaatacatttttttagggtatattaaaccaaggcataaggagt |
48579208 |
T |
 |
| Q |
311 |
attgccgggaaaagttacaaacataaaaactctagcatgagaattttaaagggaaaagtataaaggacttttcctctcaataccggttc |
399 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48579207 |
attgccgggaaaagttacaaacataaaaactctagcatgagaattttaaagggaaaagtataaaggacttttcctctcaataccggttc |
48579119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University