View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19766_high_8 (Length: 297)
Name: NF19766_high_8
Description: NF19766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19766_high_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 19 - 288
Target Start/End: Complemental strand, 2730726 - 2730457
Alignment:
| Q |
19 |
cttcatgcatgagaggaagggttcttcaagcttcttgattcaaagttcagtgaattcatagattttacggtgatacaattcaaaggaaccatctagatgt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2730726 |
cttcatgcatgagaggaagggttcttcaaccttcttgattcaaagttcagagaattcatagattttacagtgatacaattcaaaggaaccatctagatgt |
2730627 |
T |
|
| Q |
119 |
ggcatagatcctagtgtttttctcttaaaacggggttgataggtggatctttcaccatttcaattgtaggtaaaaggtacaagatatgggtgaaggaaga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
2730626 |
ggcatagatcctagtgtttttctcttaaaatggggttaataggtggatctttcaccatttcaattgtaggtataaggtacaagatatgggtgaaggaaga |
2730527 |
T |
|
| Q |
219 |
agatttacggtggatgaatgggcggaggaacaacggtgaaggtagttcgattgagggtgatggttcatct |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
2730526 |
agatttacggtggatgaatgggcggaggaacaacagtgaaggtagttcgattgagggtgatggttcatct |
2730457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University