View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19766_low_14 (Length: 270)
Name: NF19766_low_14
Description: NF19766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19766_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 7e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 89 - 259
Target Start/End: Complemental strand, 30887762 - 30887592
Alignment:
| Q |
89 |
gacatttctcacaatcacaaaatatgatcagtttcacaaataaaggaaaatttgattgacctgtcttatgaaaactattgctttcattttgtttcacaaa |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30887762 |
gacatttctcacaatcacaaaatatgatcagtttcacaaataaaggaaaatttgattgacctgtcttatgaaaactattgctttcattttgtttcacaaa |
30887663 |
T |
|
| Q |
189 |
taaacatgcactactgtcttatgaaaccacaccttaactgcaatattttcttactttctattctatttcat |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30887662 |
taaacatgcactactgtcttatgaaaccacaccttaactgcaatattttcttactttctattctatttcat |
30887592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University