View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19767_high_7 (Length: 253)
Name: NF19767_high_7
Description: NF19767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19767_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 22 - 238
Target Start/End: Original strand, 40288924 - 40289134
Alignment:
| Q |
22 |
atggaggcagtcaaagttcgtgtacaaactcagcctggctttgctcgtggtttgtctgatgggttacccaagtttgtcaaggctgatggtgtttctgggt |
121 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40288924 |
atggaggctgtcaaagttcgtgtacaaactcagcctggctttgctcgtggtttgtctgatgggttacccaagtttgtcaaggctgatggtgtttctgggt |
40289023 |
T |
 |
| Q |
122 |
acgnnnnnnnnnnnnnnatcctaaatgttaattgcttctagtcttttttgttgcttcttatcatacataagatatgtagcatcgacacttcagatggatg |
221 |
Q |
| |
|
|| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40289024 |
ac----tttttttttttatcctaaatgttaattgcttctagtc--ttttgttgcttcttatcatacataagatatgtagcatcgacacttcatatggatg |
40289117 |
T |
 |
| Q |
222 |
gtgtgtatggtgttcat |
238 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
40289118 |
gtgtgtatggtgttcat |
40289134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University