View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19767_high_9 (Length: 217)
Name: NF19767_high_9
Description: NF19767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19767_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 4e-99; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 18 - 204
Target Start/End: Original strand, 49303936 - 49304122
Alignment:
| Q |
18 |
agatttgggtaccgatcgatgctacactatagaggaggatccaagccctctgtttagccttcttttttcggggttaaatgtaatgtttttgatgtaatgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49303936 |
agatttgggtaccgatcgatgctacactatagaggaggatccaagccctctgtttagccttcttttttcggggttaaatgtaatgtttttgatgtaatgt |
49304035 |
T |
 |
| Q |
118 |
tctctttttgataagtatgataattaataaatatggatccatgagttatctttttgtatcaataatttgtttttgtataagtattat |
204 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49304036 |
tctctttttgataagtatgacaattaataaatatggatccatgagttatctttttgtatcaataatttgtttttgtataagtattat |
49304122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 68 - 104
Target Start/End: Original strand, 49290319 - 49290355
Alignment:
| Q |
68 |
tgtttagccttcttttttcggggttaaatgtaatgtt |
104 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |
|
|
| T |
49290319 |
tgtttagccttcttttttaagggttaaatgtaatgtt |
49290355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 68 - 104
Target Start/End: Original strand, 49297270 - 49297306
Alignment:
| Q |
68 |
tgtttagccttcttttttcggggttaaatgtaatgtt |
104 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |
|
|
| T |
49297270 |
tgtttagccttcttttttaagggttaaatgtaatgtt |
49297306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University