View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19767_low_13 (Length: 205)
Name: NF19767_low_13
Description: NF19767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19767_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 118; Significance: 2e-60; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 20 - 164
Target Start/End: Original strand, 24913867 - 24914014
Alignment:
| Q |
20 |
aagaagacaaacataggacttgtactgctatgctttattataaatagactaatagtaat---aaacaactaaaaactgttgacaacttactcatgcaaaa |
116 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24913867 |
aagaagacaaacataggacttgaactgctatgctttattataaatagactaataataataataaacaactaaaaactgttgacaacttactcatgcaaaa |
24913966 |
T |
 |
| Q |
117 |
attggccgaaaaaattgatctcatgctccatgaactagcaaagaaacg |
164 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
24913967 |
attggccgaaaaatttgatctcatgctccgtgaactagcaaagaaacg |
24914014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 23 - 106
Target Start/End: Original strand, 24913668 - 24913751
Alignment:
| Q |
23 |
aagacaaacataggacttgtactgctatgctttattataaatagactaatagtaataaacaactaaaaactgttgacaacttac |
106 |
Q |
| |
|
|||| ||||||| ||||||| | ||||||||||||||| ||||||||||| | |||||||||||||||||||| ||||||||| |
|
|
| T |
24913668 |
aagagaaacatatcacttgtaatactatgctttattatagatagactaatatttataaacaactaaaaactgtttacaacttac |
24913751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 23 - 73
Target Start/End: Complemental strand, 8226312 - 8226262
Alignment:
| Q |
23 |
aagacaaacataggacttgtactgctatgctttattataaatagactaata |
73 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
8226312 |
aagacaaacatataacttgtaccactatgctttattataaataaactaata |
8226262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University