View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19768_high_6 (Length: 358)
Name: NF19768_high_6
Description: NF19768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19768_high_6 |
 | |
|
| [»] scaffold0036 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0036 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 64 - 344
Target Start/End: Original strand, 5422 - 5721
Alignment:
| Q |
64 |
agaaaagtacaaagagtacttaattcataagccnnnnnnngtataaggggcttcactttgttttaaatagcatgatagaaaaacttacaaatctaaaccc |
163 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5422 |
agaaaagtacaaagagtacttaattcgtaagccaaaaaaagtataaggggcttcactttgttttaaagagcatgatagaaaaacttacaaatctaaaccc |
5521 |
T |
|
| Q |
164 |
ataaaagtgaagaagcgtgagttcaaatccacggttagagaaaattcgagcattacgcttcttttaaattatccatttgctagccagctaaataaccagg |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
5522 |
ataaaagtgaagaagcgtgagttcaaatccacggttagagaaaattcgagcattacgcttcttctaaattatccatttgctagccagccaaataaccaga |
5621 |
T |
|
| Q |
264 |
atgcaaaagtgaacttccttctccg-------------------caaatactgccaaagaaatcataaccaagaacaagatgagtgattgttttctcctt |
344 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
5622 |
atgcaaaagtgaacttccttctccgccaccgataaacaaattaccaaatactgccaaagaaatcacaaccaagaacaagatgagtgattgttttctcctt |
5721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University