View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19768_low_7 (Length: 351)
Name: NF19768_low_7
Description: NF19768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19768_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 131; Significance: 7e-68; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 131; E-Value: 7e-68
Query Start/End: Original strand, 20 - 158
Target Start/End: Complemental strand, 45666394 - 45666256
Alignment:
| Q |
20 |
tgcatgttcatgagcctctaacagaaagagttcttcggtttcattgaagaagtgatgttgttgaccataaaccaagttgatgataacaagtcctattgca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45666394 |
tgcatgttcatgagcctctaacagaaagagttcttcagtttcattgaagaagtgatgttgttgaccataaaccaagttgatgataacaagtcctattgca |
45666295 |
T |
|
| Q |
120 |
atgaaaagccagaaatgtttagccattggcgatgacaat |
158 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45666294 |
atgaaaagccagaaaagtttagccattggcgatgacaat |
45666256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 224 - 335
Target Start/End: Complemental strand, 45666240 - 45666125
Alignment:
| Q |
224 |
ctatattaacgttaacaaaggaaatttgggaggtgattaaggaaagaggtacaaag-----atatataaggcaaagnnnnnnngtggcaccgggcgggct |
318 |
Q |
| |
|
||||||||| || |||||||||||||| |||||||||||||||| ||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
45666240 |
ctatattaatgtgaacaaaggaaatttaggaggtgattaaggaa-gaggtacaaagtaaagatatataaggcaaagaaaaaaagtggcaccgggcgggct |
45666142 |
T |
|
| Q |
319 |
tctttcaagttttatta |
335 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
45666141 |
tctttcaagttttatta |
45666125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University