View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19768_low_9 (Length: 320)
Name: NF19768_low_9
Description: NF19768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19768_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 2e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 23 - 242
Target Start/End: Original strand, 51228587 - 51228800
Alignment:
| Q |
23 |
gacgcgtaattttaagatgaagggaatatcgggtaacttttaatcggactannnnnnnnnnnnnnatgaaactacgcttaaaaatacgattatttttctt |
122 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
51228587 |
gacgcgtaattttaagatgaagggaatattgggtaacttttaatcggactatttttttaattt--atgaaactacgcttaaaaatacgattatttttctt |
51228684 |
T |
|
| Q |
123 |
ttatatccttttgcatatccaattcttatgcaattgattcggaggaagaagtttgctttctcgtattgtgtgtgtcattcatatcttcttctttttttta |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
51228685 |
ttatatccttttgcatatccaattcttatgcaattgattcggaggaagaagtttgctttctcgtat----tgtgtcattcatatcttcttctttttttta |
51228780 |
T |
|
| Q |
223 |
caaaagacgttgtgccattc |
242 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
51228781 |
caaaagacgttgtgccattc |
51228800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University