View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19769_low_18 (Length: 354)
Name: NF19769_low_18
Description: NF19769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19769_low_18 |
 |  |
|
| [»] scaffold0338 (1 HSPs) |
 |  |  |
|
| [»] scaffold0035 (1 HSPs) |
 |  |  |
|
| [»] scaffold0171 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 127; Significance: 2e-65; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 166 - 346
Target Start/End: Original strand, 13123336 - 13123513
Alignment:
| Q |
166 |
gagtctagttaggctctgatttgggagtgtcggaacttttgttttatgtcatttatttgtttatggatttatctgctgagactattattatgtatgtgat |
265 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13123336 |
gagtctagttaggctctgatatgggagtgtcgggacttttgttttatgtcgtttatttgtttatggatttatctgctgagactattattatgtatgtg-- |
13123433 |
T |
 |
| Q |
266 |
cagacctaattatgtatgatgattattctgctgcaagttttatgaaaaccaacttatgcataatttgagaatatgatgatg |
346 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||||||| | ||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
13123434 |
-agacctaattatgtatgatgatttttccgctgcaagtataatgaaaaccaatttatgcatgttttgagaatatgatgatg |
13123513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 18 - 75
Target Start/End: Original strand, 13115549 - 13115604
Alignment:
| Q |
18 |
atttataggcatggaaggatatattgcaaagccacatattctatctcaaatgtggatg |
75 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
13115549 |
atttataggcatggaaggatatattgcaaagccacatat--tttctcaaatgtggatg |
13115604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 105 - 149
Target Start/End: Original strand, 13123295 - 13123339
Alignment:
| Q |
105 |
attgatttcttattgcttgtgagggcttgaggattaacttggagt |
149 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
13123295 |
attgatttcttattgcttgtgagtgcttgaggattaacttggagt |
13123339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 20891733 - 20891677
Alignment:
| Q |
104 |
gattgatttcttattgcttgtgagggcttgaggattaacttggagttacctcttatc |
160 |
Q |
| |
|
|||||||||||||||||||||||| || ||||| || ||||||| ||||||||||| |
|
|
| T |
20891733 |
gattgatttcttattgcttgtgagtactcgaggactagcttggagctacctcttatc |
20891677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0338 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0338
Description:
Target: scaffold0338; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 104 - 157
Target Start/End: Original strand, 18667 - 18720
Alignment:
| Q |
104 |
gattgatttcttattgcttgtgagggcttgaggattaacttggagttacctctt |
157 |
Q |
| |
|
|||||| |||||||| |||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
18667 |
gattgagttcttatttcttgtgagtgcttgaggattagcttggagttacctctt |
18720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0035 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: scaffold0035
Description:
Target: scaffold0035; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 111 - 163
Target Start/End: Original strand, 71415 - 71468
Alignment:
| Q |
111 |
ttcttattgcttgtgagggcttgaggattaacttggagttacct-cttatcttt |
163 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||| ||||| ||||||||| |
|
|
| T |
71415 |
ttcttattgcttgtgagtgcttgaggattagcttggagctacctccttatcttt |
71468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 104 - 157
Target Start/End: Complemental strand, 15062000 - 15061947
Alignment:
| Q |
104 |
gattgatttcttattgcttgtgagggcttgaggattaacttggagttacctctt |
157 |
Q |
| |
|
|||||| ||| ||||||||||||| |||||||||||| ||||||| |||||||| |
|
|
| T |
15062000 |
gattgagttcctattgcttgtgagtgcttgaggattagcttggagctacctctt |
15061947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 303 - 347
Target Start/End: Original strand, 24474409 - 24474453
Alignment:
| Q |
303 |
ttttatgaaaaccaacttatgcataatttgagaatatgatgatgt |
347 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |||| ||||| |
|
|
| T |
24474409 |
ttttatgaaaaccaatttatgcataatttgagaaaatgaagatgt |
24474453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0171 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0171
Description:
Target: scaffold0171; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 166 - 204
Target Start/End: Complemental strand, 2770 - 2732
Alignment:
| Q |
166 |
gagtctagttaggctctgatttgggagtgtcggaacttt |
204 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
2770 |
gagtctagttaggctctgatttaggagtgtcgggacttt |
2732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 103 - 163
Target Start/End: Original strand, 16592321 - 16592382
Alignment:
| Q |
103 |
ggattgatttcttattgcttgtgagggcttgaggattaacttggagttacct-cttatcttt |
163 |
Q |
| |
|
||||||| ||||||||||| ||||| |||||||| |||| |||||| ||||| ||||||||| |
|
|
| T |
16592321 |
ggattgagttcttattgctagtgagtgcttgagggttaatttggagctacctccttatcttt |
16592382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 166 - 260
Target Start/End: Complemental strand, 2278379 - 2278284
Alignment:
| Q |
166 |
gagtctagttaggctctgatttgggagtgtcggaact---tttgttttatgtcatttatttgtttatggatttatctgctgagactattattatgtat |
260 |
Q |
| |
|
|||||||||||||||||||||| |||||||| | ||| ||| |||| |||| ||||| || | ||||||||| |||||||||||| | ||||||| |
|
|
| T |
2278379 |
gagtctagttaggctctgatttaggagtgtcaggactttgtttcttttgtgtcttttatctgatgatggattta--tgctgagactatgactatgtat |
2278284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University