View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19769_low_19 (Length: 350)
Name: NF19769_low_19
Description: NF19769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19769_low_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 9 - 332
Target Start/End: Original strand, 45625699 - 45626022
Alignment:
| Q |
9 |
agcagagagtgggaaaagaagccacacccatttaatctacaagttagaatttccaggtgaagatgagaagaatgaaccccaggaagcactcaacattgaa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
45625699 |
agcagagagtgggaaaagaagccacacccatttaatctacaagttagaatttccaggtgaagatgagaagaatgaaccccaggaagcaatcaacattgaa |
45625798 |
T |
 |
| Q |
109 |
cgtgagggatcgttcataattcaaataaagaaccctgaagaaaaagttggtgcaggtggaggtggtttgcaaaagaaacgcaaggcggtgttcccggctc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
45625799 |
cgtgagggatcgttcataattcaaataaagaaccctgaagaaaaagttggtgcaggtggaggtggtttgcaaaagaaacgcaaggcgatgttcccggctc |
45625898 |
T |
 |
| Q |
209 |
acctgcaaggacaattaggtcatgtcagattcgccccagctgacccaccagactttctaaactatgaaggatgcgagtttttgctcatatctgcttctga |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45625899 |
acctgcaaggacaattaggtcatgtcagattcgccccagctgacccaccagactttctaaactatgaaggatgcgagtttttgctcatatctgcttctga |
45625998 |
T |
 |
| Q |
309 |
ccatattgaagatgagttgggtct |
332 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
45625999 |
ccatattgaagatgagttgggtct |
45626022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University