View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19769_low_26 (Length: 317)

Name: NF19769_low_26
Description: NF19769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19769_low_26
NF19769_low_26
[»] chr7 (2 HSPs)
chr7 (63-164)||(20558547-20558650)
chr7 (259-301)||(20558408-20558450)


Alignment Details
Target: chr7 (Bit Score: 84; Significance: 7e-40; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 63 - 164
Target Start/End: Complemental strand, 20558650 - 20558547
Alignment:
63 gttttgacaaactttatgaagaatctt-gtaagtttggactttggattagtttatcatatttttt-aataacatattgataaactcttgacttaggatta 160  Q
    ||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
20558650 gttttgacaaactttatgaagaatctttgtatgtttggactttggattagtttatcatatttttttaataacatattgataaactcttgacttaggatta 20558551  T
161 tgtc 164  Q
    ||||    
20558550 tgtc 20558547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 259 - 301
Target Start/End: Complemental strand, 20558450 - 20558408
Alignment:
259 gacacttaccaaatctatgtggaggcataggaggtaacctatt 301  Q
    |||||||||||||||||| ||||||||||||||||||||||||    
20558450 gacacttaccaaatctatttggaggcataggaggtaacctatt 20558408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University