View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19769_low_26 (Length: 317)
Name: NF19769_low_26
Description: NF19769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19769_low_26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 84; Significance: 7e-40; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 63 - 164
Target Start/End: Complemental strand, 20558650 - 20558547
Alignment:
| Q |
63 |
gttttgacaaactttatgaagaatctt-gtaagtttggactttggattagtttatcatatttttt-aataacatattgataaactcttgacttaggatta |
160 |
Q |
| |
|
||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
20558650 |
gttttgacaaactttatgaagaatctttgtatgtttggactttggattagtttatcatatttttttaataacatattgataaactcttgacttaggatta |
20558551 |
T |
 |
| Q |
161 |
tgtc |
164 |
Q |
| |
|
|||| |
|
|
| T |
20558550 |
tgtc |
20558547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 259 - 301
Target Start/End: Complemental strand, 20558450 - 20558408
Alignment:
| Q |
259 |
gacacttaccaaatctatgtggaggcataggaggtaacctatt |
301 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
20558450 |
gacacttaccaaatctatttggaggcataggaggtaacctatt |
20558408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University