View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19769_low_27 (Length: 310)
Name: NF19769_low_27
Description: NF19769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19769_low_27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 13 - 295
Target Start/End: Complemental strand, 10839920 - 10839638
Alignment:
| Q |
13 |
aaaatcttgttctatacatgttaagcttttcagttatcaacgattatgtatgatattcacatccttgcattgtcagaagttaagacactgtcggttgcgc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10839920 |
aaaatcttgttctatacatgttaagcttttcagttatcaacgattatgtatgatattcacatccttgcattgtcagaagttaagacactgtcggttgcgc |
10839821 |
T |
 |
| Q |
113 |
tgaaatacggtgtcgctcgaaacaatcataagcatgtctggttctcaagaatagtagcaaactagaaattaatcctatgacagatatacatccccaccat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10839820 |
tgaaatacggtgtcgctcgaaacaatcataagcatgtctggttctcaagaatagtagcaaactagaaattaatcctatgacagatatacatccccaccat |
10839721 |
T |
 |
| Q |
213 |
acaaatgtccagaaatagcattgtcgtcccatgcacaccaatgaatcagacattattatgtttccagttgcaggtgctgagat |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
10839720 |
acaaatgtccagaaatagcattgtcgtcccatgcacaccaatgaatcagacattattatgtttccatttccaggtgctgagat |
10839638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 191 - 247
Target Start/End: Original strand, 30348404 - 30348460
Alignment:
| Q |
191 |
gacagatatacatccccaccatacaaatgtccagaaatagcattgtcgtcccatgca |
247 |
Q |
| |
|
||||||| | ||||||||||| | |||||||||||| |||||||| | ||||||||| |
|
|
| T |
30348404 |
gacagatgtgcatccccaccagataaatgtccagaagtagcattgccttcccatgca |
30348460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University