View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19769_low_36 (Length: 257)
Name: NF19769_low_36
Description: NF19769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19769_low_36 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 72; Significance: 8e-33; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 26 - 97
Target Start/End: Original strand, 5456011 - 5456082
Alignment:
| Q |
26 |
gttatagcaatgaagcttggatattttcatgagttgaattgccaactaatacttgatgatctcatatgacac |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5456011 |
gttatagcaatgaagcttggatattttcatgagttgaattgccaactaatacttgatgatctcatatgacac |
5456082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 163 - 246
Target Start/End: Original strand, 5456148 - 5456232
Alignment:
| Q |
163 |
cagatgggaagaaaatgacatatcagcatgtttgtaacannnnnnnnnctct-aaaattgttttcatttactcataacagttcat |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5456148 |
cagatgggaagaaaatgacatatcagcatgtttgtaacatttttttttctctaaaaattgttttcatttactcataacagttcat |
5456232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University