View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19769_low_37 (Length: 255)
Name: NF19769_low_37
Description: NF19769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19769_low_37 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 16 - 236
Target Start/End: Complemental strand, 27019186 - 27018966
Alignment:
| Q |
16 |
atgcaatactaatggataaagaacttgttccaattctgactccatacttggaggtcctatataaaccctgatgtaaatcaataattgcacttttggggtt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27019186 |
atgcaatactaatggataaagaacttgttccaattctgactccatacttggaggtcctatataaaccctgatgtaaatcaataattgcacttttggggtt |
27019087 |
T |
 |
| Q |
116 |
tatttaatnnnnnnnnnnnnnttatcatagatattatagacttggaaatttgaacaaggtgaaaatatctccacaattgttcatacatcaactctagcac |
215 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
27019086 |
tatttaataaaaatgaaaaaattatcataaatattatagacttggaaatttgaacaaggtgagaatatctccacagttgttcatacatcaactctagcac |
27018987 |
T |
 |
| Q |
216 |
aaccgatccgaggataaactt |
236 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
27018986 |
aaccgatccgaggataaactt |
27018966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University