View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19769_low_44 (Length: 228)
Name: NF19769_low_44
Description: NF19769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19769_low_44 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 7 - 228
Target Start/End: Complemental strand, 42151564 - 42151345
Alignment:
| Q |
7 |
aatatttacttgatgtgatttgattgaagtaattatgtgttaccttacctgagtttatccatgtgcagtgcttggaggagaatgaggagttgataatgaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42151564 |
aatatttacttgatgtgatttgattgaagtaattatgtgttaccttacctgagtttatccatgtgcagtgcttggaggagaatgaggagttgataatgaa |
42151465 |
T |
 |
| Q |
107 |
aatactggaaggtcaaaagcaggggaagcacagcgagctcggaccgtgagtagccnnnnnnnnnnnactgtgtttaatttgtattgcttttgtttgtttc |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
42151464 |
aatactggaaggtcaaaagcaggggaagcacagcgagctcggaccgtgagtagcc--tttttttttactgtgtttaatttgtattgcttttgtttgtttc |
42151367 |
T |
 |
| Q |
207 |
taggtattatcaagtggtttaa |
228 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
42151366 |
taggtattatcaagtggtttaa |
42151345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 73 - 147
Target Start/End: Original strand, 30835550 - 30835624
Alignment:
| Q |
73 |
agtgcttggaggagaatgaggagttgataatgaaaatactggaaggtcaaaagcaggggaagcacagcgagctcg |
147 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
30835550 |
agtgcttggaggagaacgaggagttgataatggcaatactggaaggtcaaaagcaggggaagcacggcgagctcg |
30835624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University