View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1976_high_8 (Length: 227)
Name: NF1976_high_8
Description: NF1976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1976_high_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 79 - 226
Target Start/End: Complemental strand, 42800098 - 42799950
Alignment:
| Q |
79 |
gttgatttgtatgattattgtgagggtttgatgttggatacaggtttggacctcatttgtgaaaattgaaattcatggtggtggattttc-nnnnnnnag |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |||| ||||||||||||| ||||||||||||||||||||||||||||||||||| | |
|
|
| T |
42800098 |
gttgatttgtatgattattgtgagggtttggtgttagataaaggtttggacctcctttgtgaaaattgaaattcatggtggtggattttcttttttttaa |
42799999 |
T |
 |
| Q |
178 |
ggattttacacgttaatggtggactcatctttacagaagagaaagaata |
226 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42799998 |
ggattttacacgttaatggtggactgatctttacagaagagaaagaata |
42799950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University