View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1976_low_6 (Length: 234)
Name: NF1976_low_6
Description: NF1976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1976_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 19 - 170
Target Start/End: Complemental strand, 42799941 - 42799789
Alignment:
| Q |
19 |
atggaggttgtttgaaggttcgaggaaacaggaattatttgttcatgcnnnnnnnnnnnn-tgttaaaagaacaacctgtagagccggtaaacaggttac |
117 |
Q |
| |
|
||||||||| |||||||||| | ||||||| ||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
42799941 |
atggaggttatttgaaggttggtggaaacatgaattatttgttcatgcaaaaaaaaaaaaatgttaaaagaacaacctgttgagccggtaaacaggttac |
42799842 |
T |
|
| Q |
118 |
tactcttaaaaaagttgttacgtgggccaatagggtagcgtgtgtttagcagc |
170 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42799841 |
tactcataaaaaagttgttacgtgggccaatagggtagcgtgtgtttagcagc |
42799789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University