View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19770_high_4 (Length: 276)
Name: NF19770_high_4
Description: NF19770
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19770_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 1 - 267
Target Start/End: Original strand, 41277582 - 41277848
Alignment:
| Q |
1 |
tagcggtgttaccaaatgtgatgatcaccctcattggtccaagcatccatacaaataggacaaatgagtccatcaatatcggtacggttgcattcattct |
100 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41277582 |
tagcagtgttaccaaatgtgatgatcgccctcattggtccaagcatccatacaaataggacaaatgagtccatcaatatcggtacggttgcattcattct |
41277681 |
T |
 |
| Q |
101 |
cttggctacaatcaacactttcaatcggaatcgacaacgaagaagcctctcctccttcaattctgcggcgtttgtttatctcgtcgccgggaataacact |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
41277682 |
cttggctacaatcaacactttcaatcggaatcgacaacgaagaagcctctcctccttcaattctgcggcgtttgtttctctcgtcgccgggaataacact |
41277781 |
T |
 |
| Q |
201 |
tacttcgtcggatcgggaaaccctagacgacggcacatcgggaacatattcttcatcgtcttcatct |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41277782 |
tacttcgtcggatcgggaaaccctagacgacggcacatcgggaacatattcttcatcgtcttcatct |
41277848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University