View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19770_low_6 (Length: 256)
Name: NF19770_low_6
Description: NF19770
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19770_low_6 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 249
Target Start/End: Complemental strand, 7454963 - 7454715
Alignment:
| Q |
1 |
tgaaacatattaagttgtgnnnnnnngcagcaagatcagaaccataattaagtgtaaacaattaacatccaaactaaatgcaaaaatagtgcataatcaa |
100 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7454963 |
tgaaacatattaagttgtgtttttttgcagcaacatcagaaccataattaagtgtaaacaattaacatccaaactaaatgcaaaaatagtgcataatcaa |
7454864 |
T |
|
| Q |
101 |
tgaaaatgatctaaagtaaatcttaccaaagatttatgcatggatgcacgacgttagaagcttgtctgcacaataagaatcattgaaaaacatgtagttc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7454863 |
tgaaaatgatctaaagtaaatcttaccaaagatttatgcatggatgcacaacgttagaagcttgtctgcacaataagaatcattgaaaaacatgtagttc |
7454764 |
T |
|
| Q |
201 |
caattcatcttaaggaggagatatttagtgagtttcttatgtccctttg |
249 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
7454763 |
caattcatcttaaggaggagatatttattgagtttcttatgtctctttg |
7454715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University