View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19772_high_8 (Length: 263)

Name: NF19772_high_8
Description: NF19772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19772_high_8
NF19772_high_8
[»] chr1 (1 HSPs)
chr1 (2-246)||(883847-884095)


Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 2 - 246
Target Start/End: Complemental strand, 884095 - 883847
Alignment:
2 tttgtgtttactattgattttcttgtggnnnnnnnggtagagggaacatatgcatattgtatagtgcaatttttggcta----ggtttgacttgctatag 97  Q
    |||| |||||||||| ||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||    |||||||||||||||||    
884095 tttgagtttactattaattttcttgtggtttttttggtagagggaacatatgcatattgtatagtgcaatttttggctatgtaggtttgacttgctatag 883996  T
98 agaaagggaaataaagtgacaaaaaattgcattgcgggctgatgagatattttccaagaatgaatgtttgtcttgtaattgtggttaactacttaactta 197  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
883995 agaaatggaaataaagtgacaaaaaattgcattgcgggctgatgagatattttccaagaatgaatgtttgtcttgtaattgtggttaactacttaactta 883896  T
198 tattcccatggatttttcatttaatggaatagagttttgatacttttta 246  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
883895 tattcccatggatttttcatttaatggaatagagttttgatacttttta 883847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University