View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19772_low_8 (Length: 288)
Name: NF19772_low_8
Description: NF19772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19772_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 82 - 271
Target Start/End: Complemental strand, 38052670 - 38052481
Alignment:
| Q |
82 |
ttggctttcaacttctgaagcgtggtgaacttatatattcgtttagtggtnnnnnnnnttgaggtaccggattgaagagattgaatgctttttgtatata |
181 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
38052670 |
ttggctttcaacttctcaagcgtggtgaacttatatattcgtttagtggtaaaaaaaattgaggtaccggattgaagagattgaatattttttgtatata |
38052571 |
T |
|
| Q |
182 |
cttgtgtcatgtccaaataagttatctagatgtctcttaacgattcttaatgtccaaataagctctctagataactcttaatgacatgtt |
271 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38052570 |
cttgtgtcatgtccaaataagttctctagatgtctcttaacgactcttaatgtccaaatacgctctctagataactcttaatgacatgtt |
38052481 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University