View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19772_low_9 (Length: 263)
Name: NF19772_low_9
Description: NF19772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19772_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 2 - 246
Target Start/End: Complemental strand, 884095 - 883847
Alignment:
| Q |
2 |
tttgtgtttactattgattttcttgtggnnnnnnnggtagagggaacatatgcatattgtatagtgcaatttttggcta----ggtttgacttgctatag |
97 |
Q |
| |
|
|||| |||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
884095 |
tttgagtttactattaattttcttgtggtttttttggtagagggaacatatgcatattgtatagtgcaatttttggctatgtaggtttgacttgctatag |
883996 |
T |
 |
| Q |
98 |
agaaagggaaataaagtgacaaaaaattgcattgcgggctgatgagatattttccaagaatgaatgtttgtcttgtaattgtggttaactacttaactta |
197 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
883995 |
agaaatggaaataaagtgacaaaaaattgcattgcgggctgatgagatattttccaagaatgaatgtttgtcttgtaattgtggttaactacttaactta |
883896 |
T |
 |
| Q |
198 |
tattcccatggatttttcatttaatggaatagagttttgatacttttta |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
883895 |
tattcccatggatttttcatttaatggaatagagttttgatacttttta |
883847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University