View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19773_high_63 (Length: 262)
Name: NF19773_high_63
Description: NF19773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19773_high_63 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 14 - 254
Target Start/End: Original strand, 33907454 - 33907695
Alignment:
| Q |
14 |
ctttgcctgttgtatccattctcgaaacgagaatgtatagaacgatgggttggtgtatccctgcgttgaagccaaacatattgaaggactgtt-aaccac |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
33907454 |
ctttgcctgttgtatccattctcgaaacgagaatgtatagaacgatgggttggtgtatccctgcgttgaagccaaacatattgaaggcctgtttaaccac |
33907553 |
T |
 |
| Q |
113 |
ttggttgacgttgtggtcaacctaattggttgcaatatttcaacacaacgttgctattgtggtggttggtaaagtttacaccattgcattggttatgggc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33907554 |
ttggttgacgttgtggtcaacctaattggttgcaatatttcaacacaacgttgctattgtggtggttggtaaagtttacaccattgcattggttatgggc |
33907653 |
T |
 |
| Q |
213 |
caaaacattaacatcgtgtcccttgtgattgtcgttcggcct |
254 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33907654 |
caaaacattaacgtcgtgtcccttgtgattgtcgttcggcct |
33907695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University