View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19773_high_68 (Length: 251)
Name: NF19773_high_68
Description: NF19773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19773_high_68 |
 | |
|
| [»] chr5 (3 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 220; Significance: 1e-121; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 8 - 251
Target Start/End: Complemental strand, 35629479 - 35629236
Alignment:
| Q |
8 |
cgaagaatatgtatccatttaaattgccaaattcttattaccttttttgttgtggatttagccatggttggcttgcaacaatggataaaagttatgccat |
107 |
Q |
| |
|
||||||| |||||||||||||||||||||||| ||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35629479 |
cgaagaaaatgtatccatttaaattgccaaatccttattaccatatttgttgtggatttagccatggttggcttgcaacaatggataaaagttatgccat |
35629380 |
T |
|
| Q |
108 |
aacaatattgcatccttctaagaatgttgctcctattagtcttccaaccctcggtcgatcatatacaagattacctgaggtcgggtacaaggtcactctt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
35629379 |
aacaatattgcatccttctaagaatgttgctcctattagtcttccaaccctcggtcgatcatatacaagattatctgaggtcgggtaccaggtcactctt |
35629280 |
T |
|
| Q |
208 |
tctgctgaccctataacaagaccaaatgattatatggttgcggc |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35629279 |
tctgctgaccctataacaagaccaaatgattatatggttgcggc |
35629236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 196 - 239
Target Start/End: Complemental strand, 35625579 - 35625536
Alignment:
| Q |
196 |
aaggtcactctttctgctgaccctataacaagaccaaatgatta |
239 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
35625579 |
aaggttactctttctgctgaccctataataagaccaaatgatta |
35625536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 107 - 159
Target Start/End: Complemental strand, 35625668 - 35625616
Alignment:
| Q |
107 |
taacaatattgcatccttctaagaatgttgctcctattagtcttccaaccctc |
159 |
Q |
| |
|
|||| |||||| |||||| |||||||||||||| ||||||||||||| ||||| |
|
|
| T |
35625668 |
taactatattgaatccttttaagaatgttgctcatattagtcttccacccctc |
35625616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University