View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19773_high_69 (Length: 250)
Name: NF19773_high_69
Description: NF19773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19773_high_69 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 35042508 - 35042750
Alignment:
| Q |
1 |
tagcagctgatttctagaaaattcaaatgctctttctgcatgaaggcgaaaagaaacacagttcaaacatgtgcaaagccctctgcatcctcttgggttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35042508 |
tagcagctgatttctagaaaattcaaatgctctttctgcatgaaggcgaaaagaaacacagttcaaacatgtgcaaagccctctgcatcctcttgggttt |
35042607 |
T |
|
| Q |
101 |
tttctcaaaattccttttcgggaactaacggcaagggcatcatgttgatctgtgactttcattttggacaagctccgacaacatccaggtgtttcaggtg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35042608 |
tttctcaaaattccttttcgggaactaacggcaagggcatcatgttgatctctgactttcattttggacaagctccgacaacatccaggtgtttcaggtg |
35042707 |
T |
|
| Q |
201 |
atttctctccgttggacaaggcaggtgaacctacttcttctct |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35042708 |
atttctctccgttggacaaggcaggtgaacctacttcttctct |
35042750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University