View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19773_high_85 (Length: 228)
Name: NF19773_high_85
Description: NF19773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19773_high_85 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 47592249 - 47592044
Alignment:
| Q |
1 |
ttaccttgggatagttaagaacaggggaactagcagtatcatcaagaggtgaagactgttgacttttcctaccatattctttacccttctttttggattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47592249 |
ttaccttgggatagttaagaacaggggaactagcagtatcatcaagaggtgaagactgttgacttttcctaccatattctttacccttctttttggattc |
47592150 |
T |
 |
| Q |
101 |
tttggaagttgaagaatgccaatttacacaataaggttgttggtaattttcctctacatgatagtactgaggaggtccagaagaagcatcagaaaccatg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
47592149 |
tttggaagttgaagaatgccaatttacacaataaggttgttggtaattttcctctacatgatagtactgtggaggtccagaagaagcatcagaaaccatg |
47592050 |
T |
 |
| Q |
201 |
gataaa |
206 |
Q |
| |
|
|||||| |
|
|
| T |
47592049 |
gataaa |
47592044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University