View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19773_high_91 (Length: 205)
Name: NF19773_high_91
Description: NF19773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19773_high_91 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 21 - 175
Target Start/End: Original strand, 10069261 - 10069415
Alignment:
| Q |
21 |
tgatggccagcctgcctcaacttattgttttcgaggatttcaaggatgatgacaattgtcttgttgatgagagaggaaataagttttggtggtttcattc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10069261 |
tgatggccagcctgcctcaacttattgttttcgaggatttcaaggatgatgacaattgtcttgttgatgagagaggaaataagttttggtggtttcattc |
10069360 |
T |
|
| Q |
121 |
ttcttgtttttgagacgattaactaaacgcaacgcagatactcacatgcctcttt |
175 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
10069361 |
ttcttgtttttgagacgattaactgaacgcaacgcagaaactcacatgcctcttt |
10069415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University