View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19773_low_43 (Length: 364)
Name: NF19773_low_43
Description: NF19773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19773_low_43 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 49 - 331
Target Start/End: Original strand, 51809307 - 51809580
Alignment:
| Q |
49 |
gaaaagaaataatagataattccataccagtggaatgacttcatgggtgggatgagattgacgagatttgcataacccttgatgagttcatcaatcttct |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51809307 |
gaaaagaaataatagataattccataccagtggaatgacttcatgggtgggatgagattgacgagatttgcataacccttgatgagttcatcaatcttct |
51809406 |
T |
 |
| Q |
149 |
cttgagagatttcatccttgaactttgcgatcactatgtgcttcacagccatttctcttttttgtttgctttccacttctcacctgctacttagttagtt |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51809407 |
cttgagagatttcatccttgaactttgcgatcactatgtgcttcacagccatttctcttttttgtttgctttccacttctcacctgctacttagttagtt |
51809506 |
T |
 |
| Q |
249 |
accagtcagtactaccactatctcatttttctaggattaggatatttttcttagaacaaaaaatgggttaaatgtttttaata |
331 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51809507 |
accagt----actaccactat-----ttttctaggattaggatatttttcttagaacaaaaaatgggttaaatgtttttaata |
51809580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University