View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19773_low_52 (Length: 335)
Name: NF19773_low_52
Description: NF19773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19773_low_52 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 314; Significance: 1e-177; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 1 - 318
Target Start/End: Complemental strand, 1150664 - 1150347
Alignment:
| Q |
1 |
gtttagttgctaagagtaggttgttgggaagtgctgatgattttggcggtgatgaaatgggatatgatcatcaaacaccgaaacctaaaatgcatcttaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1150664 |
gtttagttgctaagagtaggttgttgggaagtgctgatgattttggtggtgatgaaatgggatatgatcatcaaacaccgaaacctaaaatgcatcttaa |
1150565 |
T |
 |
| Q |
101 |
aatcggggaaggtgttccaattattttggttccgagtgcttttcagacacttattactatctataatgttaaggattttttggaagatggggtttatgta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1150564 |
aatcggggaaggtgttccaattattttggttccgagtgcttttcagacacttattactatctataatgttaaggattttttggaagatggggtttatgta |
1150465 |
T |
 |
| Q |
201 |
cctactgatgttaaggttaaagcgatgaaaggtgctaagccggattgtgttactgttcagaagaagcttagtagggatagagctgttactgcttatgaag |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1150464 |
cctactgatgttaaggttaaagcgatgaaaggtgctaagccggattgtgttactgttcagaagaagcttagtagggatagagctgttactgcttatgaag |
1150365 |
T |
 |
| Q |
301 |
ttagggataagccttctg |
318 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
1150364 |
ttagggataagccttctg |
1150347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University