View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19773_low_70 (Length: 262)

Name: NF19773_low_70
Description: NF19773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19773_low_70
NF19773_low_70
[»] chr8 (1 HSPs)
chr8 (14-254)||(33907454-33907695)


Alignment Details
Target: chr8 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 14 - 254
Target Start/End: Original strand, 33907454 - 33907695
Alignment:
14 ctttgcctgttgtatccattctcgaaacgagaatgtatagaacgatgggttggtgtatccctgcgttgaagccaaacatattgaaggactgtt-aaccac 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||    
33907454 ctttgcctgttgtatccattctcgaaacgagaatgtatagaacgatgggttggtgtatccctgcgttgaagccaaacatattgaaggcctgtttaaccac 33907553  T
113 ttggttgacgttgtggtcaacctaattggttgcaatatttcaacacaacgttgctattgtggtggttggtaaagtttacaccattgcattggttatgggc 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33907554 ttggttgacgttgtggtcaacctaattggttgcaatatttcaacacaacgttgctattgtggtggttggtaaagtttacaccattgcattggttatgggc 33907653  T
213 caaaacattaacatcgtgtcccttgtgattgtcgttcggcct 254  Q
    |||||||||||| |||||||||||||||||||||||||||||    
33907654 caaaacattaacgtcgtgtcccttgtgattgtcgttcggcct 33907695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University