View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19773_low_76 (Length: 250)

Name: NF19773_low_76
Description: NF19773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19773_low_76
NF19773_low_76
[»] chr8 (1 HSPs)
chr8 (1-243)||(35042508-35042750)


Alignment Details
Target: chr8 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 35042508 - 35042750
Alignment:
1 tagcagctgatttctagaaaattcaaatgctctttctgcatgaaggcgaaaagaaacacagttcaaacatgtgcaaagccctctgcatcctcttgggttt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35042508 tagcagctgatttctagaaaattcaaatgctctttctgcatgaaggcgaaaagaaacacagttcaaacatgtgcaaagccctctgcatcctcttgggttt 35042607  T
101 tttctcaaaattccttttcgggaactaacggcaagggcatcatgttgatctgtgactttcattttggacaagctccgacaacatccaggtgtttcaggtg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
35042608 tttctcaaaattccttttcgggaactaacggcaagggcatcatgttgatctctgactttcattttggacaagctccgacaacatccaggtgtttcaggtg 35042707  T
201 atttctctccgttggacaaggcaggtgaacctacttcttctct 243  Q
    |||||||||||||||||||||||||||||||||||||||||||    
35042708 atttctctccgttggacaaggcaggtgaacctacttcttctct 35042750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University