View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19773_low_77 (Length: 250)
Name: NF19773_low_77
Description: NF19773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19773_low_77 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 22 - 250
Target Start/End: Original strand, 48248285 - 48248516
Alignment:
| Q |
22 |
atcaagaacgtgagtctttggttaaaaagaaacgatcaaaacgaccgcgtat------tggtaacccacccactgaagaagaatatcttgctctctgtct |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48248285 |
atcaagaacgtgagtctttggttaaaaagaaacgatcaaaacgaccgcgtattggtattggtaacccacccactgaagaagaatatcttgctctctgtct |
48248384 |
T |
|
| Q |
116 |
catcatgctctcacaaagcaacaaacaaattgaatcatcaccgttgaagcagctcaatcacaagtgcagtgtttgtaacaaagcttttccatcttatcaa |
215 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
48248385 |
catcatgctctcacaaagcaacaaccaaattcaatcatcaccgttga---agctcaatcacaagtgcagtgtttgcaacaaagcttttccatcttatcaa |
48248481 |
T |
|
| Q |
216 |
gcacttggtggtcacaaagccagccaccgcaaatc |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
48248482 |
gcacttggtggtcacaaagccagccaccgcaaatc |
48248516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 86 - 124
Target Start/End: Original strand, 5294569 - 5294607
Alignment:
| Q |
86 |
cactgaagaagaatatcttgctctctgtctcatcatgct |
124 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
5294569 |
cactgaagaagaatatctcgctctttgtctcatcatgct |
5294607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 192 - 244
Target Start/End: Complemental strand, 47436080 - 47436028
Alignment:
| Q |
192 |
aacaaagcttttccatcttatcaagcacttggtggtcacaaagccagccaccg |
244 |
Q |
| |
|
|||||||||||| ||||||||||||| || ||||| ||||||||||| ||||| |
|
|
| T |
47436080 |
aacaaagctttttcatcttatcaagccctaggtggacacaaagccagtcaccg |
47436028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University