View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19773_low_79 (Length: 248)
Name: NF19773_low_79
Description: NF19773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19773_low_79 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 10 - 127
Target Start/End: Original strand, 39557968 - 39558085
Alignment:
| Q |
10 |
atgacagtatggtatggtttcttttatagaaagtttgttatcattttttcacttgattatgttactttacaactctgtatccaccagatgcagaggaatt |
109 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39557968 |
atgaaagtatggtatggtttcttttatagaaagtttgttatcattttttcacttaattatgttactttacaactctgtatccaccagatgcagaggaatt |
39558067 |
T |
 |
| Q |
110 |
tcagtattgaatatgtta |
127 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
39558068 |
tcagtattgaatatgtta |
39558085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 136 - 248
Target Start/End: Original strand, 39558161 - 39558273
Alignment:
| Q |
136 |
atttaatttttatttcaaaaccattgattgtaagtaaattttaatgttttacttacaaccatgatcatgatatgattcatttgaattatagctccacgca |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39558161 |
atttaatttttatttcaaaaccattgattgtaagtaaattttaatgttttacttacaaccatgatcatggtatgattcatttgaattatagctccacgca |
39558260 |
T |
 |
| Q |
236 |
tgactggaatttt |
248 |
Q |
| |
|
||||||||||||| |
|
|
| T |
39558261 |
tgactggaatttt |
39558273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University